GPLD1

GPLD1

 

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

DLR-GPLD1-Hu-96T DL Develop 96T
 
EUR 673
  • Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-48Tests Reddot Biotech 48 Tests
 
EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RD-GPLD1-Hu-96Tests Reddot Biotech 96 Tests
 
EUR 723

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-48Tests Reddot Biotech 48 Tests
 
EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit

RDR-GPLD1-Hu-96Tests Reddot Biotech 96 Tests
 
EUR 756

GPLD1 Antibody

ABD9750 Lifescience Market 100 ug
 
EUR 438

GPLD1 siRNA

20-abx918384 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 siRNA

20-abx918385 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GPLD1 antibody

39044-100ul SAB 100ul
 
EUR 252

GPLD1 Antibody

DF9750 Affbiotech 200ul
 
EUR 304
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

GPLD1 Antibody

1-CSB-PA009721LA01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-GPLD1

YF-PA12100 Abfrontier 50 ul
 
EUR 363
Description: Mouse polyclonal to GPLD1

anti-GPLD1

YF-PA12101 Abfrontier 50 ug
 
EUR 363
Description: Mouse polyclonal to GPLD1

GPLD1 Conjugated Antibody

C39044 SAB 100ul
 
EUR 397

GPLD1 cloning plasmid

CSB-CL009721HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 531
  • Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc
  • Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Rabbit pAb

A6612-100ul Abclonal 100 ul
 
EUR 308

GPLD1 Rabbit pAb

A6612-200ul Abclonal 200 ul
 
EUR 459

GPLD1 Rabbit pAb

A6612-20ul Abclonal 20 ul
 
EUR 183

GPLD1 Rabbit pAb

A6612-50ul Abclonal 50 ul
 
EUR 223

GPLD1 Blocking Peptide

DF9750-BP Affbiotech 1mg
 
EUR 195

Anti-GPLD1 antibody

STJ28695 St John's Laboratory 100 µl
 
EUR 277
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Rat GPLD1 shRNA Plasmid

20-abx988490 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GPLD1 ELISA Kit

ELA-E13691h Lifescience Market 96 Tests
 
EUR 824

GPLD1 ELISA KIT|Human

EF005585 Lifescience Market 96 Tests
 
EUR 689

Human GPLD1 shRNA Plasmid

20-abx951887 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GPLD1 Antibody, HRP conjugated

1-CSB-PA009721LB01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPLD1 Antibody, FITC conjugated

1-CSB-PA009721LC01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPLD1 Antibody, Biotin conjugated

1-CSB-PA009721LD01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPLD1 ORF Vector (Human) (pORF)

ORF004583 ABM 1.0 ug DNA
 
EUR 95

Gpld1 ORF Vector (Rat) (pORF)

ORF067750 ABM 1.0 ug DNA
 
EUR 506

Gpld1 ORF Vector (Mouse) (pORF)

ORF046446 ABM 1.0 ug DNA
 
EUR 506

GPLD1 ELISA Kit (Human) (OKAN05580)

OKAN05580 Aviva Systems Biology 96 Wells
 
EUR 792
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

GPLD1 ELISA Kit (Human) (OKCD09132)

OKCD09132 Aviva Systems Biology 96 Wells
 
EUR 975
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL

GPLD1 ELISA Kit (Human) (OKEH02315)

OKEH02315 Aviva Systems Biology 96 Wells
 
EUR 662
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

GPLD1 ELISA Kit (Bovine) (OKEH03927)

OKEH03927 Aviva Systems Biology 96 Wells
 
EUR 779
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL

Polyclonal GPLD1 Antibody - N-terminal region

APR01631G Leading Biology 0.05mg
 
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPLD1 - N-terminal region. This antibody is tested and proven to work in the following applications:

GPLD1 sgRNA CRISPR Lentivector set (Human)

K0888101 ABM 3 x 1.0 ug
 
EUR 339

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx129033 Abbexa
  •  
    EUR 425.00
  •  
    EUR 133.00
  •  
    EUR 1205.00
  •  
    EUR 578.00
  •  
    EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx005070 Abbexa
  •  
    EUR 411.00
  •  
    EUR 592.00
  •  
    EUR 182.00
  •  
    EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody

20-abx172649 Abbexa
  •  
    EUR 857.00
  •  
    EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Gpld1 sgRNA CRISPR Lentivector set (Mouse)

K3398501 ABM 3 x 1.0 ug
 
EUR 339

Gpld1 sgRNA CRISPR Lentivector set (Rat)

K7343301 ABM 3 x 1.0 ug
 
EUR 339

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)

4-RPH975Hu01 Cloud-Clone
  •  
    EUR 476.32
  •  
    EUR 230.00
  •  
    EUR 1511.20
  •  
    EUR 570.40
  •  
    EUR 1040.80
  •  
    EUR 382.00
  •  
    EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P80108
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0888102 ABM 1.0 ug DNA
 
EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0888103 ABM 1.0 ug DNA
 
EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0888104 ABM 1.0 ug DNA
 
EUR 154

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein

20-abx168135 Abbexa
  •  
    EUR 662.00
  •  
    EUR 272.00
  •  
    EUR 2040.00
  •  
    EUR 787.00
  •  
    EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3398502 ABM 1.0 ug DNA
 
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3398503 ABM 1.0 ug DNA
 
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3398504 ABM 1.0 ug DNA
 
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7343302 ABM 1.0 ug DNA
 
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7343303 ABM 1.0 ug DNA
 
EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7343304 ABM 1.0 ug DNA
 
EUR 154

There are no products listed under this category.