We are part of the Gentaur group

Nova Tech

Biomatik Proteins

Fine Test

MBS

Life Science M

Mybiosource

Gentaur

Fine Test Ltd

Nova Life

Bioscience

Zeptometrix

Life Science Tech

Fine Biotech

Nova LifeTech

Gentaur Ltd.

Science Market

Immunology Consultatnt Laboratory

Wuhan Fine Biotech

Biovision

Genprice

Sphero Fluorescent

Bioworld

Gentaur Molecular

Genprice Inc.

101Bio

Sphero Beads

IBT

Sphero Magnetic

Intact Genomics

Sphero Rainbow

Abbott

Stress Marq Biosciences

Jaica

ALPHAGEN Extractions

Arthus Bio

Eurofins

Sphero Blue

Chondrex

Sphero Calibration

Vazyme

Smart Science

Sphero Blank

Sphero Silica

Sphero Carboxyl

Abbott Panbio

Beijing Wantai Biological

Invbio

Spherotech Beads

Vivadiag

View all Brands

Nova Tech

Biomatik Proteins

Fine Test

MBS

Life Science M

Mybiosource

Gentaur

Fine Test Ltd

Nova Life

Bioscience

Zeptometrix

Life Science Tech

Fine Biotech

Nova LifeTech

Gentaur Ltd.

Science Market

Immunology Consultatnt Laboratory

Wuhan Fine Biotech

Biovision

Genprice

Sphero Fluorescent

Bioworld

Gentaur Molecular

Genprice Inc.

101Bio

Sphero Beads

IBT

Sphero Magnetic

Intact Genomics

Sphero Rainbow

Abbott

Stress Marq Biosciences

Jaica

ALPHAGEN Extractions

Arthus Bio

Eurofins

Sphero Blue

Chondrex

Sphero Calibration

Vazyme

Smart Science

Sphero Blank

Sphero Silica

Sphero Carboxyl

Abbott Panbio

Beijing Wantai Biological

Invbio

Spherotech Beads

Vivadiag

View all Brands

GPLD1

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
DLR-GPLD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

GPLD1 Antibody
ABD9750	Lifescience Market	100 ug	EUR 438

GPLD1 siRNA
20-abx918384	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPLD1 siRNA
20-abx918385	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPLD1 antibody
39044-100ul	SAB	100ul	EUR 252

GPLD1 Antibody
DF9750	Affbiotech	200ul	EUR 304
Description: GPLD1 Antibody detects endogenous levels of total GPLD1.

GPLD1 Antibody
1-CSB-PA009721LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-GPLD1
YF-PA12100	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to GPLD1

anti-GPLD1
YF-PA12101	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GPLD1

GPLD1 Conjugated Antibody
C39044	SAB	100ul	EUR 397

GPLD1 cloning plasmid
CSB-CL009721HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 531 Sequence: atgtctgctttcaggttgtggcctggcctgctgatcatgttgggttctctctgccatagaggttcaccgtgtggcctttcaacacacatagaaataggacacagagctctggagtttcttcagcttcacaatgggcgtgttaactacagagagctgttactagaacaccaggatgc Show more
Description: A cloning plasmid for the GPLD1 gene.

GPLD1 Rabbit pAb
A6612-100ul	Abclonal	100 ul	EUR 308

GPLD1 Rabbit pAb
A6612-200ul	Abclonal	200 ul	EUR 459

GPLD1 Rabbit pAb
A6612-20ul	Abclonal	20 ul	EUR 183

GPLD1 Rabbit pAb
A6612-50ul	Abclonal	50 ul	EUR 223

GPLD1 Blocking Peptide
DF9750-BP	Affbiotech	1mg	EUR 195

Anti-GPLD1 antibody
STJ28695	St John's Laboratory	100 µl	EUR 277
Description: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.

Rat GPLD1 shRNA Plasmid
20-abx988490	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPLD1 ELISA Kit
ELA-E13691h	Lifescience Market	96 Tests	EUR 824

GPLD1 ELISA KIT\|Human
EF005585	Lifescience Market	96 Tests	EUR 689

Human GPLD1 shRNA Plasmid
20-abx951887	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPLD1 Antibody, HRP conjugated
1-CSB-PA009721LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPLD1 Antibody, FITC conjugated
1-CSB-PA009721LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPLD1 Antibody, Biotin conjugated
1-CSB-PA009721LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPLD1. Recognizes GPLD1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPLD1 ORF Vector (Human) (pORF)
ORF004583	ABM	1.0 ug DNA	EUR 95

Gpld1 ORF Vector (Rat) (pORF)
ORF067750	ABM	1.0 ug DNA	EUR 506

Gpld1 ORF Vector (Mouse) (pORF)
ORF046446	ABM	1.0 ug DNA	EUR 506

GPLD1 ELISA Kit (Human) (OKAN05580)
OKAN05580	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 ng/mL

GPLD1 ELISA Kit (Human) (OKCD09132)
OKCD09132	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34ng/mL

GPLD1 ELISA Kit (Human) (OKEH02315)
OKEH02315	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22 ng/mL

GPLD1 ELISA Kit (Bovine) (OKEH03927)
OKEH03927	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: This protein hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans (GPI-anchor) thus releasing these proteins from the membrane.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.41 ng/mL

Polyclonal GPLD1 Antibody - N-terminal region
APR01631G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPLD1 - N-terminal region. This antibody is tested and proven to work in the following applications:

GPLD1 sgRNA CRISPR Lentivector set (Human)
K0888101	ABM	3 x 1.0 ug	EUR 339

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx129033	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx005070	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Antibody
20-abx172649	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Gpld1 sgRNA CRISPR Lentivector set (Mouse)
K3398501	ABM	3 x 1.0 ug	EUR 339

Gpld1 sgRNA CRISPR Lentivector set (Rat)
K7343301	ABM	3 x 1.0 ug	EUR 339

Recombinant Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1)
4-RPH975Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P80108 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 40.7kDa Isoelectric Point: 6.9
Description: Recombinant Human Glycosylphosphatidylinositol Specific Phospholipase D1 expressed in: E.coli

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0888102	ABM	1.0 ug DNA	EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0888103	ABM	1.0 ug DNA	EUR 154

GPLD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0888104	ABM	1.0 ug DNA	EUR 154

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) Protein
20-abx168135	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3398502	ABM	1.0 ug DNA	EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3398503	ABM	1.0 ug DNA	EUR 154

Gpld1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3398504	ABM	1.0 ug DNA	EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7343302	ABM	1.0 ug DNA	EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7343303	ABM	1.0 ug DNA	EUR 154

Gpld1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7343304	ABM	1.0 ug DNA	EUR 154

There are no products listed under this category.

Compare Selected