null
Toggle menu
020 3393 8531

    • We are part of the Gentaur group

    Shop by Category

  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands
  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands

    • NSMCE4A

    NSMCE4A

     

    NSMCE4A cloning plasmid
    CSB-CL882137HU-10ug Cusabio 10ug
     
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 951
    • Sequence: atgtctggggacagcagcggccgcgggccagagggccggggccggggccgcgacccgcatcgggatcgcacccgctcccgctcccgctcgcggtcccctttgtcgcccaggtcccgccgcggctctgcgcgggagcgcagagaggccccagagcgcccgagcctggaggacacaga
    • Show more
    Description: A cloning plasmid for the NSMCE4A gene.

    Bovine NSMCE4A ELISA KIT
    ELI-15033b Lifescience Market 96 Tests
     
    EUR 928

    Human NSMCE4A ELISA KIT
    ELI-44860h Lifescience Market 96 Tests
     
    EUR 824

    Human NSMCE4A shRNA Plasmid
    20-abx960212 Abbexa
    •  
      EUR 801.00
    •  
      EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NSMCE4A Recombinant Protein (Human)
    RP021703 ABM 100 ug Ask for price

    NSMCE4A Recombinant Protein (Rat)
    RP214622 ABM 100 ug Ask for price

    NSMCE4A Recombinant Protein (Mouse)
    RP155150 ABM 100 ug Ask for price

    NSMCE4A ORF Vector (Human) (pORF)
    ORF007235 ABM 1.0 ug DNA
     
    EUR 95

    Nsmce4a ORF Vector (Rat) (pORF)
    ORF071542 ABM 1.0 ug DNA
     
    EUR 506

     

    There are no products listed under this category.

    Compare Selected