NSMCE4A

NSMCE4A

 

NSMCE4A cloning plasmid

CSB-CL882137HU-10ug Cusabio 10ug
 
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgtctggggacagcagcggccgcgggccagagggccggggccggggccgcgacccgcatcgggatcgcacccgctcccgctcccgctcgcggtcccctttgtcgcccaggtcccgccgcggctctgcgcgggagcgcagagaggccccagagcgcccgagcctggaggacacaga
  • Show more
Description: A cloning plasmid for the NSMCE4A gene.

Bovine NSMCE4A ELISA KIT

ELI-15033b Lifescience Market 96 Tests
 
EUR 928

Human NSMCE4A ELISA KIT

ELI-44860h Lifescience Market 96 Tests
 
EUR 824

Human NSMCE4A shRNA Plasmid

20-abx960212 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NSMCE4A Recombinant Protein (Human)

RP021703 ABM 100 ug Ask for price

NSMCE4A Recombinant Protein (Rat)

RP214622 ABM 100 ug Ask for price

NSMCE4A Recombinant Protein (Mouse)

RP155150 ABM 100 ug Ask for price

NSMCE4A ORF Vector (Human) (pORF)

ORF007235 ABM 1.0 ug DNA
 
EUR 95

Nsmce4a ORF Vector (Rat) (pORF)

ORF071542 ABM 1.0 ug DNA
 
EUR 506

 

There are no products listed under this category.