null
Toggle menu
020 3393 8531

    • We are part of the Gentaur group

    Shop by Category

  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands
  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands

    • RIPK2

    RIPK2

     

    RIPK2 siRNA
    20-abx931564 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    RIPK2 siRNA
    20-abx931565 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    RIPK2 antibody
    70R-32732 Fitzgerald 100 ug
     
    EUR 327.00
    Description: Rabbit polyclonal RIPK2 antibody

    RIPK2, Active
    7747-5 Biovision  
     
    EUR 370.00

    RIPK2 Antibody
    ABD2641 Lifescience Market 100 ug
     
    EUR 438.00

    RIPK2 Antibody
    ABD6967 Lifescience Market 100 ug
     
    EUR 438.00

    RIPK2 protein
    30R-2861 Fitzgerald 5 ug
     
    EUR 503.00
    Description: Purified recombinant Human RIPK2 protein

    RIPK2 Antibody
    32675-100ul SAB 100ul
     
    EUR 252.00

    RIPK2 antibody
    70R-19904 Fitzgerald 50 ul
     
    EUR 435.00
    Description: Rabbit polyclonal RIPK2 antibody

    RIPK2 antibody
    70R-10459 Fitzgerald 50 ug
     
    EUR 467.00
    Description: Affinity purified rabbit polyclonal RIPK2 antibody

    RIPK2 Antibody
    DF6967 Affbiotech 200ul
     
    EUR 304.00
    Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

    RIPK2 Antibody
    DF2641 Affbiotech 200ul
     
    EUR 304.00
    Description: RIPK2 antibody detects endogenous levels of total RIPK2.

    RIPK2 Antibody
    1-CSB-PA070143 Cusabio
    •  
      EUR 222.00
    •  
      EUR 195.00
    • 0
    • 1
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

    RIPK2 Antibody
    1-CSB-PA019736ESR1HU Cusabio
    •  
      EUR 222.00
    •  
      EUR 335.00
    • 0
    • 1
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    RIPK2 Antibody
    1-CSB-PA019736GA01HU Cusabio
    •  
      EUR 597.00
    •  
      EUR 333.00
    • 0
    • 1
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    RIPK2 Antibody
    1-CSB-PA019736LA01HU Cusabio
    •  
      EUR 317.00
    •  
      EUR 335.00
    • 0
    • 1
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

    RIPK2 Conjugated Antibody
    C32675 SAB 100ul
     
    EUR 397.00

    RIPK2 Blocking Peptide
    AF7618-BP Affbiotech 1mg
     
    EUR 195.00

    RIPK2 cloning plasmid
    CSB-CL019736HU-10ug Cusabio 10ug
     
    EUR 376.00
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1623
    • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
    • Show more
    Description: A cloning plasmid for the RIPK2 gene.

    anti- RIPK2 antibody
    FNab07314 FN Test 100µg
     
    EUR 548.75
    • Immunogen: receptor-interacting serine-threonine kinase 2
    • Uniprot ID: O43353
    • Gene ID: 8767
    • Research Area: Immunology, Signal Transduction, Metabolism
    Description: Antibody raised against RIPK2

    RIPK2 (pS176) Antibody
    abx011477-100ug Abbexa 100 ug
     
    EUR 439.00
    • Shipped within 5-10 working days.

    RIPK2 (pS176) Antibody
    abx011478-100ug Abbexa 100 ug
     
    EUR 439.00
    • Shipped within 5-10 working days.

    RIPK2 Polyclonal Antibody
    A54388 EpiGentek 100 µg
     
    EUR 570.55
    Description: kits suitable for this type of research

    There are no products listed under this category.

    Compare Selected