TMED7

TMED7

 

TMED7 siRNA
20-abx937004 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pENTR223- TMED7
PVT11471 Lifescience Market 2 ug
 
EUR 273
TMED7 cloning plasmid
CSB-CL896886HU-10ug Cusabio 10ug
 
EUR 299
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: atgccgcggccggggtccgcgcagcgctgggcggccgtcgcgggccgttgggggtgcaggctgctcgcactgctgctactggtgcctggacccggcggcgcctctgagatcaccttcgagcttcctgacaacgccaagcagtgcttctacgaggacatcgctcagggcaccaagtg
  • Show more
Description: A cloning plasmid for the TMED7 gene.
Human TMED7 ELISA KIT
ELI-29359h Lifescience Market 96 Tests
 
EUR 824
Rat TMED7 shRNA Plasmid
20-abx988016 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TMED7 shRNA Plasmid
20-abx959455 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TMED7 Recombinant Protein (Rat)
RP233402 ABM 100 ug Ask for price
TMED7 Recombinant Protein (Human)
RP031831 ABM 100 ug Ask for price
TMED7 Recombinant Protein (Mouse)
RP179165 ABM 100 ug Ask for price
Tmed7 ORF Vector (Rat) (pORF)
ORF077802 ABM 1.0 ug DNA
 
EUR 506
TMED7 ORF Vector (Human) (pORF)
ORF010611 ABM 1.0 ug DNA
 
EUR 95
Tmed7 ORF Vector (Mouse) (pORF)
ORF059723 ABM 1.0 ug DNA
 
EUR 506
TMED7-TICAM2 Recombinant Protein (Human)
RP101930 ABM 100 ug Ask for price
Tmed7 sgRNA CRISPR Lentivector set (Rat)
K7473701 ABM 3 x 1.0 ug
 
EUR 339
Tmed7 sgRNA CRISPR Lentivector set (Mouse)
K3169001 ABM 3 x 1.0 ug
 
EUR 339
TMED7 sgRNA CRISPR Lentivector set (Human)
K2385601 ABM 3 x 1.0 ug
 
EUR 339
TMED7-TICAM2 ORF Vector (Human) (pORF)
ORF033978 ABM 1.0 ug DNA Ask for price
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7473702 ABM 1.0 ug DNA
 
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7473703 ABM 1.0 ug DNA
 
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7473704 ABM 1.0 ug DNA
 
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3169002 ABM 1.0 ug DNA
 
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3169003 ABM 1.0 ug DNA
 
EUR 154
Tmed7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3169004 ABM 1.0 ug DNA
 
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector set (Human)
K2811201 ABM 3 x 1.0 ug
 
EUR 339
TMED7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2385602 ABM 1.0 ug DNA
 
EUR 154
TMED7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2385603 ABM 1.0 ug DNA
 
EUR 154
TMED7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2385604 ABM 1.0 ug DNA
 
EUR 154
TMED7 Protein Vector (Rat) (pPB-C-His)
PV311206 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Rat) (pPB-N-His)
PV311207 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Rat) (pPM-C-HA)
PV311208 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Rat) (pPM-C-His)
PV311209 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Mouse) (pPB-C-His)
PV238890 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Mouse) (pPB-N-His)
PV238891 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Mouse) (pPM-C-HA)
PV238892 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Mouse) (pPM-C-His)
PV238893 ABM 500 ng
 
EUR 603
TMED7 Protein Vector (Human) (pPB-C-His)
PV042441 ABM 500 ng
 
EUR 329
TMED7 Protein Vector (Human) (pPB-N-His)
PV042442 ABM 500 ng
 
EUR 329
TMED7 Protein Vector (Human) (pPM-C-HA)
PV042443 ABM 500 ng
 
EUR 329
TMED7 Protein Vector (Human) (pPM-C-His)
PV042444 ABM 500 ng
 
EUR 329
Tmed7 3'UTR Luciferase Stable Cell Line
TU120604 ABM 1.0 ml Ask for price
Tmed7 3'UTR GFP Stable Cell Line
TU170604 ABM 1.0 ml Ask for price
Tmed7 3'UTR Luciferase Stable Cell Line
TU221990 ABM 1.0 ml Ask for price
TMED7 3'UTR GFP Stable Cell Line
TU075701 ABM 1.0 ml
 
EUR 1521
Tmed7 3'UTR GFP Stable Cell Line
TU271990 ABM 1.0 ml Ask for price
TMED7 3'UTR Luciferase Stable Cell Line
TU025701 ABM 1.0 ml
 
EUR 1521
TMED7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV698689 ABM 1.0 ug DNA
 
EUR 514
TMED7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV698693 ABM 1.0 ug DNA
 
EUR 514
TMED7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV698694 ABM 1.0 ug DNA
 
EUR 514
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2811202 ABM 1.0 ug DNA
 
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2811203 ABM 1.0 ug DNA
 
EUR 154
TMED7-TICAM2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2811204 ABM 1.0 ug DNA
 
EUR 154
TMED7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV793105 ABM 1.0 ug DNA
 
EUR 316
TMED7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV793106 ABM 1.0 ug DNA
 
EUR 316
TMED7-TICAM2 Protein Vector (Human) (pPB-C-His)
PV135910 ABM 500 ng Ask for price

There are no products listed under this category.