UBE2B

UBE2B

 

UBE2B antibody
22642-100ul SAB 100ul
 
EUR 390
UBE2B antibody
70R-12534 Fitzgerald 100 ul
 
EUR 457
Description: Affinity purified Rabbit polyclonal UBE2B antibody
UBE2B antibody
70R-21096 Fitzgerald 50 ul
 
EUR 435
Description: Rabbit polyclonal UBE2B antibody
UBE2B antibody
38818-100ul SAB 100ul
 
EUR 252
UBE2B Antibody
42801-100ul SAB 100ul
 
EUR 252
UBE2B Antibody
1-CSB-PA778345 Cusabio
  •  
    EUR 317.00
  •  
    EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UBE2B Antibody
1-CSB-PA170670 Cusabio
  •  
    EUR 317.00
  •  
    EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
UBE2B Antibody
1-CSB-PA025439GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against UBE2B. Recognizes UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
UBE2B siRNA
20-abx905903 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2B siRNA
20-abx938755 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UBE2B siRNA
20-abx938756 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-Ube2B
YF-PA15195 Abfrontier 50 ul
 
EUR 363
Description: Mouse polyclonal to Ube2B
anti-Ube2B
YF-PA15196 Abfrontier 50 ug
 
EUR 363
Description: Mouse polyclonal to Ube2B
anti-Ube2B
YF-PA24926 Abfrontier 50 ul
 
EUR 334
Description: Mouse polyclonal to Ube2B
UBE2A/UBE2B Antibody
1-CSB-PA004716 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against UBE2A/UBE2B. Recognizes UBE2A/UBE2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000
UBE2B Conjugated Antibody
C38818 SAB 100ul
 
EUR 397
UBE2A / UBE2B Antibody
20-abx327177 Abbexa
  •  
    EUR 314.00
  •  
    EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
UBE2B cloning plasmid
CSB-CL025439HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 459
  • Sequence: atgtcgaccccggcccggaggaggctcatgcgggatttcaagcggttacaagaggacccacctgtgggtgtcagtggcgcaccatctgaaaacaacatcatgcagtggaatgcagttatatttggaccagaagggacaccttttgaagatggtacttttaaactagtaatagaatt
  • Show more
Description: A cloning plasmid for the UBE2B gene.
UBE2B Rabbit pAb
A6315-100ul Abclonal 100 ul
 
EUR 308
UBE2B Rabbit pAb
A6315-200ul Abclonal 200 ul
 
EUR 459
UBE2B Rabbit pAb
A6315-20ul Abclonal 20 ul
 
EUR 183
UBE2B Rabbit pAb
A6315-50ul Abclonal 50 ul
 
EUR 223
anti- UBE2B antibody
FNab09164 FN Test 100µg
 
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ubiquitin-conjugating enzyme E2B (RAD6 homolog)
  • Uniprot ID: P63146
  • Gene ID: 7320
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism, Developmental biology
Description: Antibody raised against UBE2B
Anti-UBE2B antibody
PAab09164 Lifescience Market 100 ug
 
EUR 386
Anti-UBE2B antibody
STJ28237 St John's Laboratory 100 µl
 
EUR 277
Description: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution.

 

There are no products listed under this category.