null

POM121

POM121

 

POM121 Transmembrane Nucleoporin (POM121) Antibody

20-abx121664 Abbexa
  •  
    EUR 300.00
  •  
    EUR 439.00
  •  
    EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Pom121/ Rat Pom121 ELISA Kit

ELI-21714r Lifescience Market 96 Tests
 
EUR 886.00

POM121 Transmembrane Nucleoporin (POM121) Antibody

abx236636-100ug Abbexa 100 ug
 
EUR 481.00
  • Shipped within 5-12 working days.

POM121 Antibody

45454-100ul SAB 100ul
 
EUR 252.00

POM121 Antibody

45454-50ul SAB 50ul
 
EUR 187.00

POM121 Antibody

DF8708 Affbiotech 200ul
 
EUR 304.00
Description: POM121 Antibody detects endogenous levels of total POM121.

POM121 siRNA

20-abx904132 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 siRNA

20-abx929246 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 siRNA

20-abx929247 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 Antibody

ABD8708 Lifescience Market 100 ug
 
EUR 438.00

Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit

abx382368-96tests Abbexa 96 tests
 
EUR 911.00
  • Shipped within 5-12 working days.

Anti-POM121 Antibody

A06856 BosterBio 100ul
 
EUR 397.00
Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

POM121 Blocking Peptide

DF8708-BP Affbiotech 1mg
 
EUR 195.00

POM121 Blocking Peptide

20-abx161374 Abbexa
  •  
    EUR 606.00
  •  
    EUR 1428.00
  • 0
  • 1
  • Shipped within 5-10 working days.

POM121 Conjugated Antibody

C45454 SAB 100ul
 
EUR 397.00

POM121 cloning plasmid

CSB-CL846630HU-10ug Cusabio 10ug
 
EUR 558.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga
  • Show more
Description: A cloning plasmid for the POM121 gene.

POM121 Polyclonal Antibody

ABP57122-003ml Abbkine 0.03ml
 
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
  • Applications tips:
Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

There are no products listed under this category.