null
Toggle menu
020 3393 8531

    • We are part of the Gentaur group

    Shop by Category

  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • AffiPLASMID
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands
  • 2019-nCoV Antibody
  • 2019-nCoV Protein
  • AccuCount
  • Allergen
  • Antibody
  • Antigen
  • Assay Developers
  • Assay Kit
  • Blocking Peptides
  • Cells
  • Clinical Laboratories
  • COVID-19
  • DNA
  • Elisa Kit
  • Elisa Kits
  • Extraction
  • Flow Cytometry
  • Gentaur Antibodies
  • Humanazied Antibody
  • Humanized monoclonal antibody
  • IBT Bioservices
  • ICL Antibodies
  • ICL ELISA
  • ICL Isotype Control
  • ICL Loading Control
  • ICL Protein Standard
  • Immuno-Histo Chemistry
  • Medium & Cell Culture
  • ORLA Gentaur
  • Oxidation
  • PCR Kit
  • Rabbit polyclonal antibody
  • SAH Antibodies
  • SAM Antibodies
  • SD Bioline
  • Serum
  • Stem Cell Marker
  • Virus
  • Antibodies
  • Assay
  • Cell
  • Coronavirus
  • ExoQuick
  • Fluorescence
  • Gel
  • Lab
  • Magnetic Beads
  • Molecular Biology
  • NatTrol
  • OneqPCR RealTime
  • Oxiselect
  • PAB Polyconals
  • Panbio
  • Plasmid
  • qPCR
  • QuantiChrom
  • Rainbow
  • Reagent
  • Recombinant
  • Solution
  • SPHERO
  • Spoligotyping
  • Stain
  • Monoclonal
  • Protein
  • RNA Isolation
  • Dounce homogenizer
  • Antigen ELISA
  • Assay Tests
  • Branched DNA Assay
  • Recombinant Proteins

    • Shop by Brand

  • Nova Tech
  • Biomatik Proteins
  • Fine Test
  • MBS
  • Life Science M
  • Mybiosource
  • Gentaur
  • Fine Test Ltd
  • Nova Life
  • Bioscience
  • Zeptometrix
  • Life Science Tech
  • Fine Biotech
  • Nova LifeTech
  • Gentaur Ltd.
  • Science Market
  • Immunology Consultatnt Laboratory
  • Wuhan Fine Biotech
  • Biovision
  • Genprice
  • Sphero Fluorescent
  • Bioworld
  • Gentaur Molecular
  • Genprice Inc.
  • 101Bio
  • Sphero Beads
  • IBT
  • Sphero Magnetic
  • Intact Genomics
  • Sphero Rainbow
  • Abbott
  • Stress Marq Biosciences
  • Jaica
  • ALPHAGEN Extractions
  • Arthus Bio
  • Eurofins
  • Sphero Blue
  • Chondrex
  • Sphero Calibration
  • Vazyme
  • Smart Science
  • Sphero Blank
  • Sphero Silica
  • Sphero Carboxyl
  • Abbott Panbio
  • AffiPLASMID
  • Beijing Wantai Biological
  • Invbio
  • Spherotech Beads
  • Vivadiag
  • View all Brands

    • POM121

    POM121

     

    POM121 Transmembrane Nucleoporin (POM121) Antibody
    20-abx121664 Abbexa
    •  
      EUR 300.00
    •  
      EUR 439.00
    •  
      EUR 189.00
    • 0
    • 1
    • 2
    • Shipped within 5-10 working days.

    Pom121/ Rat Pom121 ELISA Kit
    ELI-21714r Lifescience Market 96 Tests
     
    EUR 886.00

    POM121 Transmembrane Nucleoporin (POM121) Antibody
    abx236636-100ug Abbexa 100 ug
     
    EUR 481.00
    • Shipped within 5-12 working days.

    POM121 Antibody
    45454-100ul SAB 100ul
     
    EUR 252.00

    POM121 Antibody
    45454-50ul SAB 50ul
     
    EUR 187.00

    POM121 Antibody
    DF8708 Affbiotech 200ul
     
    EUR 304.00
    Description: POM121 Antibody detects endogenous levels of total POM121.

    POM121 siRNA
    20-abx904132 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    POM121 siRNA
    20-abx929246 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    POM121 siRNA
    20-abx929247 Abbexa
    •  
      EUR 551.00
    •  
      EUR 732.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    POM121 Antibody
    ABD8708 Lifescience Market 100 ug
     
    EUR 438.00

    Human POM121 Transmembrane Nucleoporin (POM121) ELISA Kit
    abx382368-96tests Abbexa 96 tests
     
    EUR 911.00
    • Shipped within 5-12 working days.

    Anti-POM121 Antibody
    A06856 BosterBio 100ul
     
    EUR 397.00
    Description: Rabbit Polyclonal POM121 Antibody. Validated in WB and tested in Human, Mouse, Rat.

    POM121 Blocking Peptide
    DF8708-BP Affbiotech 1mg
     
    EUR 195.00

    POM121 Blocking Peptide
    20-abx161374 Abbexa
    •  
      EUR 606.00
    •  
      EUR 1428.00
    • 0
    • 1
    • Shipped within 5-10 working days.

    POM121 Conjugated Antibody
    C45454 SAB 100ul
     
    EUR 397.00

    POM121 cloning plasmid
    CSB-CL846630HU-10ug Cusabio 10ug
     
    EUR 558.00
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2955
    • Sequence: atggtgtgtagcccagtgactgtgaggatcgcccctcctgacagaagattttcgcgttctgcgataccagagcagataatcagctcaacactgtcctcaccatcaagtaacgccccagacccatgtgcaaaggagacagtactgagtgccctcaaagagaaggagaagaaaagga
    • Show more
    Description: A cloning plasmid for the POM121 gene.

    POM121 Polyclonal Antibody
    ABP57122-003ml Abbkine 0.03ml
     
    EUR 158.00
    • Immunogen information: Synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250
    • Applications tips:
    Description: A polyclonal antibody for detection of POM121 from Human, Mouse, Rat. This POM121 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human POM121 at AA range: 1170-1250

    There are no products listed under this category.

    Compare Selected