null

RIPK2

RIPK2

 

RIPK2 siRNA

20-abx931564 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RIPK2 siRNA

20-abx931565 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RIPK2 antibody

70R-32732 Fitzgerald 100 ug
 
EUR 327.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2, Active

7747-5 Biovision  
 
EUR 370.00

RIPK2 Antibody

ABD2641 Lifescience Market 100 ug
 
EUR 438.00

RIPK2 Antibody

ABD6967 Lifescience Market 100 ug
 
EUR 438.00

RIPK2 protein

30R-2861 Fitzgerald 5 ug
 
EUR 503.00
Description: Purified recombinant Human RIPK2 protein

RIPK2 Antibody

32675-100ul SAB 100ul
 
EUR 252.00

RIPK2 antibody

70R-19904 Fitzgerald 50 ul
 
EUR 435.00
Description: Rabbit polyclonal RIPK2 antibody

RIPK2 antibody

70R-10459 Fitzgerald 50 ug
 
EUR 467.00
Description: Affinity purified rabbit polyclonal RIPK2 antibody

RIPK2 Antibody

DF6967 Affbiotech 200ul
 
EUR 304.00
Description: RIPK2 Antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

DF2641 Affbiotech 200ul
 
EUR 304.00
Description: RIPK2 antibody detects endogenous levels of total RIPK2.

RIPK2 Antibody

1-CSB-PA070143 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

RIPK2 Antibody

1-CSB-PA019736ESR1HU Cusabio
  •  
    EUR 222.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RIPK2 Antibody

1-CSB-PA019736GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RIPK2 Antibody

1-CSB-PA019736LA01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RIPK2. Recognizes RIPK2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

RIPK2 Conjugated Antibody

C32675 SAB 100ul
 
EUR 397.00

RIPK2 Blocking Peptide

AF7618-BP Affbiotech 1mg
 
EUR 195.00

RIPK2 cloning plasmid

CSB-CL019736HU-10ug Cusabio 10ug
 
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1623
  • Sequence: atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtg
  • Show more
Description: A cloning plasmid for the RIPK2 gene.

anti- RIPK2 antibody

FNab07314 FN Test 100µg
 
EUR 548.75
  • Immunogen: receptor-interacting serine-threonine kinase 2
  • Uniprot ID: O43353
  • Gene ID: 8767
  • Research Area: Immunology, Signal Transduction, Metabolism
Description: Antibody raised against RIPK2

RIPK2 (pS176) Antibody

abx011477-100ug Abbexa 100 ug
 
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 (pS176) Antibody

abx011478-100ug Abbexa 100 ug
 
EUR 439.00
  • Shipped within 5-10 working days.

RIPK2 Polyclonal Antibody

A54388 EpiGentek 100 µg
 
EUR 570.55
Description: kits suitable for this type of research

There are no products listed under this category.