nfya

NFYA

 

NFYA siRNA

20-abx903550 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFYA siRNA

20-abx925850 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFYA siRNA

20-abx925851 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NFYA antibody

70R-50129 Fitzgerald 100 ul
 
EUR 244
Description: Purified Polyclonal NFYA antibody

NFYA antibody

70R-31644 Fitzgerald 100 ug
 
EUR 327
Description: Rabbit polyclonal NFYA antibody

NFYA Antibody

ABD3125 Lifescience Market 100 ug
 
EUR 438

NFYA Antibody

33722-100ul SAB 100ul
 
EUR 252

NFYA Antibody

33722-50ul SAB 50ul
 
EUR 187

NFYA antibody

70R-18866 Fitzgerald 50 ul
 
EUR 435
Description: Rabbit polyclonal NFYA antibody

NFYA Antibody

DF3125 Affbiotech 200ul
 
EUR 304
Description: NFYA Antibody detects endogenous levels of total NFYA.

NFYA Antibody

1-CSB-PA003424 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

NFYA Antibody

CSB-PA288741- Cusabio  
 
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFYA Antibody

CSB-PA288741-100ul Cusabio 100ul
 
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

NFYA Antibody

1-CSB-PA015773GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NFYA. Recognizes NFYA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

pUC19-NFYA

PVT17593 Lifescience Market 2 ug
 
EUR 231

anti-NFYA

YF-PA24243 Abfrontier 50 ul
 
EUR 334
Description: Mouse polyclonal to NFYA

NFYA Conjugated Antibody

C33722 SAB 100ul
 
EUR 397

NFYA cloning plasmid

CSB-CL015773HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 957
  • Sequence: atggagcagtatacagcaaacagcaatagttcgacagagcagattgttgtccaggcaggacagattcagcagcaggtccaagggcagccattaatggtgcaggtcagtggaggccagctaatcacatcaactggccaacccatcatggtccaggctgtccctggtgggcaaggtca
  • Show more
Description: A cloning plasmid for the NFYA gene.

anti- NFYA antibody

FNab05716 FN Test 100µg
 
EUR 505.25
  • Immunogen: nuclear transcription factor Y, alpha
  • Uniprot ID: P23511
  • Gene ID: 4800
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against NFYA

NFYA Blocking Peptide

20-abx063004 Abbexa
  •  
    EUR 272.00
  •  
    EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NFYA Rabbit pAb

A1998-100ul Abclonal 100 ul
 
EUR 308

NFYA Rabbit pAb

A1998-200ul Abclonal 200 ul
 
EUR 459

NFYA Rabbit pAb

A1998-20ul Abclonal 20 ul
 
EUR 183

NFYA Rabbit pAb

A1998-50ul Abclonal 50 ul
 
EUR 223

NFYA Blocking Peptide

DF3125-BP Affbiotech 1mg
 
EUR 195

Anti-NFYA antibody

PAab05716 Lifescience Market 100 ug
 
EUR 355

pECMV-NFYA-3

PVT17624 Lifescience Market 2 ug
 
EUR 258

Anti-NFYA antibody

STJ111124 St John's Laboratory 100 µl
 
EUR 277
Description: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms.

Rat NFYA shRNA Plasmid

20-abx985549 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NFYA ELISA KIT

ELI-13647h Lifescience Market 96 Tests
 
EUR 824

Bovine NFYA ELISA KIT

ELI-22188b Lifescience Market 96 Tests
 
EUR 928

NFYA ELISA KIT|Human

EF001216 Lifescience Market 96 Tests
 
EUR 689

Mouse Nfya ELISA KIT

ELI-44625m Lifescience Market 96 Tests
 
EUR 865

Human NFYA shRNA Plasmid

20-abx953186 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NFYA shRNA Plasmid

20-abx971739 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NFYA Recombinant Protein (Human)

RP021172 ABM 100 ug Ask for price

NFYA Recombinant Protein (Rat)

RP213854 ABM 100 ug Ask for price

NFYA Recombinant Protein (Mouse)

RP153989 ABM 100 ug Ask for price

NFYA Recombinant Protein (Mouse)

RP153992 ABM 100 ug Ask for price

NFYA ORF Vector (Human) (pORF)

ORF007058 ABM 1.0 ug DNA
 
EUR 95

Nfya ORF Vector (Rat) (pORF)

ORF071286 ABM 1.0 ug DNA
 
EUR 506

Nfya ORF Vector (Mouse) (pORF)

ORF051331 ABM 1.0 ug DNA
 
EUR 506

Nfya ORF Vector (Mouse) (pORF)

ORF051332 ABM 1.0 ug DNA
 
EUR 506

NFYA sgRNA CRISPR Lentivector set (Human)

K1423901 ABM 3 x 1.0 ug
 
EUR 339

Nfya sgRNA CRISPR Lentivector set (Mouse)

K3857701 ABM 3 x 1.0 ug
 
EUR 339

Nfya sgRNA CRISPR Lentivector set (Rat)

K6930201 ABM 3 x 1.0 ug
 
EUR 339

NFYA DNA-Binding ELISA Kit (OKAG00424)

OKAG00424 Aviva Systems Biology 96 Wells
 
EUR 753
Description: Description of target: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms.;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Qualitative DNA Binding ELISA ;Sensitivity:

NFYA sgRNA CRISPR Lentivector (Human) (Target 1)

K1423902 ABM 1.0 ug DNA
 
EUR 154

NFYA sgRNA CRISPR Lentivector (Human) (Target 2)

K1423903 ABM 1.0 ug DNA
 
EUR 154

NFYA sgRNA CRISPR Lentivector (Human) (Target 3)

K1423904 ABM 1.0 ug DNA
 
EUR 154

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3857702 ABM 1.0 ug DNA
 
EUR 154

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3857703 ABM 1.0 ug DNA
 
EUR 154

Nfya sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3857704 ABM 1.0 ug DNA
 
EUR 154

There are no products listed under this category.