PIGG

PIGG

 

PIGG cloning plasmid

CSB-CL711091HU-10ug Cusabio 10ug
 
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1815
  • Sequence: atgtcagaaagattgcatgggaactggatcagactgtacttggaggaaaagcattcagaagtcctattcaacctgggctccaaggttctcaggcagtacctggatgctctgaagacgctgagcttgtccctgagtgcacaagtggcccagtacgacatctattcgatgatggtgg
  • Show more
Description: A cloning plasmid for the PIGG gene.

pCMV-SPORT6-PIGG

PVT12604 Lifescience Market 2 ug
 
EUR 391

pCMV-SPORT6-PIGG

PVT12829 Lifescience Market 2 ug
 
EUR 391

Human PIGG shRNA Plasmid

20-abx960282 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PIGG ORF Vector (Human) (pORF)

ORF007816 ABM 1.0 ug DNA
 
EUR 95

Pigg ORF Vector (Mouse) (pORF)

ORF054011 ABM 1.0 ug DNA
 
EUR 506

Pigg sgRNA CRISPR Lentivector set (Mouse)

K3148501 ABM 3 x 1.0 ug
 
EUR 339

PIGG sgRNA CRISPR Lentivector set (Human)

K1647301 ABM 3 x 1.0 ug
 
EUR 339

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3148502 ABM 1.0 ug DNA
 
EUR 154

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3148503 ABM 1.0 ug DNA
 
EUR 154

Pigg sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3148504 ABM 1.0 ug DNA
 
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 1)

K1647302 ABM 1.0 ug DNA
 
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 2)

K1647303 ABM 1.0 ug DNA
 
EUR 154

PIGG sgRNA CRISPR Lentivector (Human) (Target 3)

K1647304 ABM 1.0 ug DNA
 
EUR 154

PIGG Protein Vector (Human) (pPB-C-His)

PV031261 ABM 500 ng
 
EUR 329

PIGG Protein Vector (Human) (pPB-N-His)

PV031262 ABM 500 ng
 
EUR 329

PIGG Protein Vector (Human) (pPM-C-HA)

PV031263 ABM 500 ng
 
EUR 329

PIGG Protein Vector (Human) (pPM-C-His)

PV031264 ABM 500 ng
 
EUR 329

PIGG Protein Vector (Mouse) (pPB-C-His)

PV216042 ABM 500 ng
 
EUR 1065

PIGG Protein Vector (Mouse) (pPB-N-His)

PV216043 ABM 500 ng
 
EUR 1065

PIGG Protein Vector (Mouse) (pPM-C-HA)

PV216044 ABM 500 ng
 
EUR 1065

PIGG Protein Vector (Mouse) (pPM-C-His)

PV216045 ABM 500 ng
 
EUR 1065

Pigg 3'UTR Luciferase Stable Cell Line

TU116349 ABM 1.0 ml Ask for price

Pigg 3'UTR GFP Stable Cell Line

TU166349 ABM 1.0 ml Ask for price

Pigg 3'UTR Luciferase Stable Cell Line

TU216227 ABM 1.0 ml Ask for price

Pigg 3'UTR GFP Stable Cell Line

TU266227 ABM 1.0 ml Ask for price

PIGG 3'UTR GFP Stable Cell Line

TU067933 ABM 1.0 ml
 
EUR 1521

PIGG 3'UTR Luciferase Stable Cell Line

TU017933 ABM 1.0 ml
 
EUR 1521

Human GPI ethanolamine phosphate transferase 2, PIGG ELISA KIT

ELI-20960h Lifescience Market 96 Tests
 
EUR 824

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3148505 ABM 3 x 1.0 ug
 
EUR 376

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1647305 ABM 3 x 1.0 ug
 
EUR 376

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3148506 ABM 1.0 ug DNA
 
EUR 167

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3148507 ABM 1.0 ug DNA
 
EUR 167

Pigg sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3148508 ABM 1.0 ug DNA
 
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1647306 ABM 1.0 ug DNA
 
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1647307 ABM 1.0 ug DNA
 
EUR 167

PIGG sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1647308 ABM 1.0 ug DNA
 
EUR 167

There are no products listed under this category.