null

psmb3

PSMB3

 

PSMB3 antibody

70R-19584 Fitzgerald 50 ul
 
EUR 435
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 antibody

70R-2348 Fitzgerald 50 ug
 
EUR 467
Description: Rabbit polyclonal PSMB3 antibody

PSMB3 Antibody

1-CSB-PA018880ESR1HU Cusabio
  •  
    EUR 222.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

PSMB3 Antibody

1-CSB-PA018880GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PSMB3. Recognizes PSMB3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PSMB3 siRNA

20-abx904312 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB3 siRNA

20-abx930146 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMB3 siRNA

20-abx930147 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PSMB3

YF-PA14110 Abfrontier 50 ug
 
EUR 363
Description: Mouse polyclonal to PSMB3

anti-PSMB3

YF-PA14111 Abfrontier 50 ug
 
EUR 363
Description: Mouse polyclonal to PSMB3

anti-PSMB3

YF-PA24500 Abfrontier 50 ul
 
EUR 334
Description: Mouse polyclonal to PSMB3

PSMB3 Blocking Peptide

33R-5230 Fitzgerald 100 ug
 
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PSMB3 antibody, catalog no. 70R-2348

PSMB3 Polyclonal Antibody

31780-100ul SAB 100ul
 
EUR 252

PSMB3 Polyclonal Antibody

31780-50ul SAB 50ul
 
EUR 187

PSMB3 cloning plasmid

CSB-CL018880HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 618
  • Sequence: atgtctattatgtcctataacggaggggccgtcatggccatgaaggggaagaactgtgtggccatcgctgcagacaggcgcttcgggatccaggcccagatggtgaccacggacttccagaagatctttcccatgggtgaccggctgtacatcggtctggccgggctcgccactga
  • Show more
Description: A cloning plasmid for the PSMB3 gene.

PSMB3 Rabbit pAb

A9947-100ul Abclonal 100 ul
 
EUR 308

PSMB3 Rabbit pAb

A9947-200ul Abclonal 200 ul
 
EUR 459

PSMB3 Rabbit pAb

A9947-20ul Abclonal 20 ul
 
EUR 183

PSMB3 Rabbit pAb

A9947-50ul Abclonal 50 ul
 
EUR 223

anti- PSMB3 antibody

FNab06872 FN Test 100µg
 
EUR 505.25
  • Immunogen: proteasome(prosome, macropain) subunit, beta type, 3
  • Uniprot ID: P49720
  • Gene ID: 5691
  • Research Area: Metabolism
Description: Antibody raised against PSMB3

Anti-PSMB3 antibody

PAab06872 Lifescience Market 100 ug
 
EUR 355

Anti-PSMB3 antibody

STJ111988 St John's Laboratory 100 µl
 
EUR 277
Description: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants

Anti-PSMB3 antibody

STJ72347 St John's Laboratory 100 µg
 
EUR 359

Polyclonal PSMB3 Antibody (Center)

APR04876G Leading Biology 0.1ml
 
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

PSMB3 protein (His tag)

80R-2047 Fitzgerald 100 ug
 
EUR 424
Description: Recombinant human PSMB3 protein (His tag)

PSMB3 ELISA KIT|Human

EF002114 Lifescience Market 96 Tests
 
EUR 689

Mouse PSMB3 shRNA Plasmid

20-abx973726 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat PSMB3 shRNA Plasmid

20-abx985661 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMB3 Polyclonal Conjugated Antibody

C31780 SAB 100ul
 
EUR 397

Polyclonal PSMB3 Antibody (Center)

APR06965G Leading Biology 0.1ml
 
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PSMB3 (Center). This antibody is tested and proven to work in the following applications:

Human PSMB3 shRNA Plasmid

20-abx953838 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

There are no products listed under this category.