PSMC5

PSMC5

 

PSMC5 siRNA

20-abx904323 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC5 siRNA

20-abx930170 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC5 siRNA

20-abx930171 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PSMC5 Antibody

ABD6445 Lifescience Market 100 ug
 
EUR 438

PSMC5 antibody

10R-1411 Fitzgerald 100 ug
 
EUR 512
Description: Mouse monoclonal PSMC5 antibody

PSMC5 Antibody

32302-100ul SAB 100ul
 
EUR 252

PSMC5 antibody

20R-1193 Fitzgerald 100 ug
 
EUR 377
Description: Rabbit polyclonal PSMC5 antibody

PSMC5 Antibody

DF6445 Affbiotech 200ul
 
EUR 304
Description: PSMC5 Antibody detects endogenous levels of total PSMC5.

PSMC5 Antibody

CSB-PA018895KA01HU- Cusabio  
 
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 Antibody

CSB-PA018895KA01HU-100ul Cusabio 100ul
 
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

PSMC5 Antibody

1-CSB-PA018895LA01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:2000-1:10000, IF:1:50-1:500

pOTB7-PSMC5

PVT18144 Lifescience Market 2 ug
 
EUR 231

PSMC5 Conjugated Antibody

C32302 SAB 100ul
 
EUR 397

PSMC5 cloning plasmid

CSB-CL018895HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1221
  • Sequence: atggcgcttgacggaccagagcagatggagctggaggaggggaaggcaggcagcggactccgccaatattatctgtccaagattgaagaactccagctgattgtgaatgataagagccaaaacctccggaggctgcaggcacagaggaacgaactaaatgctaaagttcgcctat
  • Show more
Description: A cloning plasmid for the PSMC5 gene.

PSMC5 Antibody (HRP)

20-abx317156 Abbexa
  •  
    EUR 411.00
  •  
    EUR 1845.00
  •  
    EUR 599.00
  •  
    EUR 182.00
  •  
    EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 Antibody (FITC)

20-abx317157 Abbexa
  •  
    EUR 411.00
  •  
    EUR 1845.00
  •  
    EUR 599.00
  •  
    EUR 182.00
  •  
    EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 Antibody (Biotin)

20-abx317158 Abbexa
  •  
    EUR 411.00
  •  
    EUR 1845.00
  •  
    EUR 599.00
  •  
    EUR 182.00
  •  
    EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PSMC5 Rabbit pAb

A1538-100ul Abclonal 100 ul
 
EUR 308

PSMC5 Rabbit pAb

A1538-200ul Abclonal 200 ul
 
EUR 459

PSMC5 Rabbit pAb

A1538-20ul Abclonal 20 ul
 
EUR 183

PSMC5 Rabbit pAb

A1538-50ul Abclonal 50 ul
 
EUR 223

PSMC5 Rabbit pAb

A13537-100ul Abclonal 100 ul
 
EUR 308

PSMC5 Rabbit pAb

A13537-200ul Abclonal 200 ul
 
EUR 459

PSMC5 Rabbit pAb

A13537-20ul Abclonal 20 ul
 
EUR 183

PSMC5 Rabbit pAb

A13537-50ul Abclonal 50 ul
 
EUR 223

PSMC5 Blocking Peptide

33R-1153 Fitzgerald 100 ug
 
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOSC2 antibody, catalog no. 70R-4705

PSMC5 Blocking Peptide

DF6445-BP Affbiotech 1mg
 
EUR 195

Anti-PSMC5 antibody

STJ25184 St John's Laboratory 100 µl
 
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Anti-PSMC5 antibody

STJ115498 St John's Laboratory 100 µl
 
EUR 277
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene.

Rat PSMC5 shRNA Plasmid

20-abx986742 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PSMC5 shRNA Plasmid

20-abx953851 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PSMC5 shRNA Plasmid

20-abx972248 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PSMC5 Antibody, HRP conjugated

1-CSB-PA018895LB01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PSMC5 Antibody, FITC conjugated

1-CSB-PA018895LC01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PSMC5 Antibody, Biotin conjugated

1-CSB-PA018895LD01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PSMC5. Recognizes PSMC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PSMC5 Recombinant Protein (Human)

RP024967 ABM 100 ug Ask for price

PSMC5 Recombinant Protein (Rat)

RP222650 ABM 100 ug Ask for price

PSMC5 Recombinant Protein (Mouse)

RP165308 ABM 100 ug Ask for price

PSMC5 ORF Vector (Human) (pORF)

ORF008323 ABM 1.0 ug DNA
 
EUR 95

Psmc5 ORF Vector (Rat) (pORF)

ORF074218 ABM 1.0 ug DNA
 
EUR 506

Psmc5 ORF Vector (Mouse) (pORF)

ORF055104 ABM 1.0 ug DNA
 
EUR 506

There are no products listed under this category.