RPL35A

RPL35A

 

RPL35A siRNA

20-abx904663 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL35A Antibody

abx147788-100ug Abbexa 100 ug
 
EUR 439
  • Shipped within 5-10 working days.

RPL35A Antibody

ABD9131 Lifescience Market 100 ug
 
EUR 438

RPL35A Antibody

ABD13240 Lifescience Market 100 ug
 
EUR 438

RPL35A Antibody

43356-100ul SAB 100ul
 
EUR 252

RPL35A Antibody

DF9131 Affbiotech 200ul
 
EUR 304
Description: RPL35A Antibody detects endogenous levels of total RPL35A.

RPL35A siRNA

20-abx931962 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL35A siRNA

20-abx931963 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL35A Antibody

1-CSB-PA020248LA01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL35A. Recognizes RPL35A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti-RPL35A

YF-PA24612 Abfrontier 50 ul
 
EUR 334
Description: Mouse polyclonal to RPL35A

RPL35A Conjugated Antibody

C43356 SAB 100ul
 
EUR 397

RPL35A cloning plasmid

CSB-CL020248HU-10ug Cusabio 10ug
 
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 333
  • Sequence: atgtctggaaggctgtggtccaaggccatttttgctggctataagcggggtctccggaaccaaagggagcacacagctcttcttaaaattgaaggtgtttacgcccgagatgaaacagaattctatttgggcaagagatgcgcttatgtatataaagcaaagaacaacacagtcac
  • Show more
Description: A cloning plasmid for the RPL35A gene.

RPL35A Polyclonal Antibody

A54938 EpiGentek 100 µg
 
EUR 570.55
Description: kits suitable for this type of research

RPL35A Rabbit pAb

A17938-100ul Abclonal 100 ul
 
EUR 308

RPL35A Rabbit pAb

A17938-200ul Abclonal 200 ul
 
EUR 459

RPL35A Rabbit pAb

A17938-20ul Abclonal 20 ul
 
EUR 183

RPL35A Rabbit pAb

A17938-50ul Abclonal 50 ul
 
EUR 223

Human RPL35A Antibody

32788-05111 AssayPro 150 ug
 
EUR 261

RPL35A Blocking Peptide

DF9131-BP Affbiotech 1mg
 
EUR 195

pCMV-SPORT6-RPL35A

PVT13292 Lifescience Market 2 ug
 
EUR 391

Anti-RPL35A antibody

STJ119922 St John's Laboratory 100 µl
 
EUR 277

Mouse RPL35A shRNA Plasmid

20-abx975035 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL35A shRNA Plasmid

20-abx985897 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL35A shRNA Plasmid

20-abx954148 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

There are no products listed under this category.