null

RPL27

RPL27

 

RPL27 siRNA

20-abx904658 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL27 Antibody

ABD9129 Lifescience Market 100 ug
 
EUR 438.00

RPL27 antibody

70R-2387 Fitzgerald 50 ug
 
EUR 467.00
Description: Rabbit polyclonal RPL27 antibody raised against the middle region of RPL27

RPL27 Antibody

45730-100ul SAB 100ul
 
EUR 252.00

RPL27 Antibody

45730-50ul SAB 50ul
 
EUR 187.00

RPL27 antibody

70R-19975 Fitzgerald 50 ul
 
EUR 435.00
Description: Rabbit polyclonal RPL27 antibody

RPL27 antibody

70R-15200 Fitzgerald 100 ug
 
EUR 327.00
Description: Rabbit polyclonal RPL27 antibody

RPL27 Antibody

DF9129 Affbiotech 200ul
 
EUR 304.00
Description: RPL27 Antibody detects endogenous levels of total RPL27.

RPL27 siRNA

20-abx931948 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL27 siRNA

20-abx931949 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL27 Antibody

1-CSB-PA020213GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL27 Antibody

1-CSB-PA02345A0Rb Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

pOTB7-RPL27

PVT18575 Lifescience Market 2 ug
 
EUR 231.00

RPL27 Conjugated Antibody

C45730 SAB 100ul
 
EUR 397.00

RPL27 cloning plasmid

CSB-CL020213HU1-10ug Cusabio 10ug
 
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: atgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaa
  • Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 cloning plasmid

CSB-CL020213HU2-10ug Cusabio 10ug
 
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgatcaaaacaaagcatctaaaaccgcagtttctggaagaaccacttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagc
  • Show more
Description: A cloning plasmid for the RPL27 gene.

anti- RPL27 antibody

FNab07426 FN Test 100µg
 
EUR 548.75
  • Immunogen: ribosomal protein L27
  • Uniprot ID: P61353
  • Gene ID: 6155
  • Research Area: Metabolism
Description: Antibody raised against RPL27

RPL27 Rabbit pAb

A5936-100ul Abclonal 100 ul
 
EUR 308.00

RPL27 Rabbit pAb

A5936-200ul Abclonal 200 ul
 
EUR 459.00

RPL27 Rabbit pAb

A5936-20ul Abclonal 20 ul Ask for price

RPL27 Rabbit pAb

A5936-50ul Abclonal 50 ul Ask for price

RPL27 Polyclonal Antibody

A52708 EpiGentek 100 µg
 
EUR 570.55
Description: fast delivery possible

RPL27 Rabbit pAb

A13044-100ul Abclonal 100 ul
 
EUR 308.00

RPL27 Rabbit pAb

A13044-200ul Abclonal 200 ul
 
EUR 459.00

RPL27 Rabbit pAb

A13044-20ul Abclonal 20 ul
 
EUR 183.00

RPL27 Rabbit pAb

A13044-50ul Abclonal 50 ul
 
EUR 223.00

RPL27 Blocking Peptide

33R-8904 Fitzgerald 100 ug
 
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL27 antibody, catalog no. 70R-2387

RPL27 antibody (HRP)

60R-1439 Fitzgerald 100 ug
 
EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (HRP)

RPL27 antibody (FITC)

60R-1440 Fitzgerald 100 ug
 
EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (FITC)

RPL27 antibody (biotin)

60R-1441 Fitzgerald 100 ug
 
EUR 327.00
Description: Rabbit polyclonal RPL27 antibody (biotin)

RPL27 Blocking Peptide

DF9129-BP Affbiotech 1mg
 
EUR 195.00

Anti-RPL27 antibody

PAab07426 Lifescience Market 100 ug
 
EUR 386.00

Anti-RPL27 antibody

STJ27732 St John's Laboratory 100 µl
 
EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL27 antibody

STJ115011 St John's Laboratory 100 µl
 
EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rat RPL27 shRNA Plasmid

20-abx986199 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL27 ELISA KIT|Human

EF002583 Lifescience Market 96 Tests
 
EUR 689.00

Canine RPL27 ELISA KIT

ELI-42598d Lifescience Market 96 Tests
 
EUR 928.00

Human RPL27 shRNA Plasmid

20-abx954140 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse RPL27 shRNA Plasmid

20-abx972493 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL27 Antibody, HRP conjugated

1-CSB-PA02345B0Rb Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL27 Antibody, FITC conjugated

1-CSB-PA02345C0Rb Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL27 Antibody, Biotin conjugated

1-CSB-PA02345D0Rb Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RPL27 Recombinant Protein (Human)

RP026929 ABM 100 ug Ask for price

RPL27 Recombinant Protein (Human)

RP026932 ABM 100 ug Ask for price

RPL27 Recombinant Protein (Rat)

RP226649 ABM 100 ug Ask for price

RPL27 Recombinant Protein (Mouse)

RP169013 ABM 100 ug Ask for price

Ribosomal Protein L27 (RPL27) Antibody

20-abx115236 Abbexa
  •  
    EUR 732.00
  •  
    EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
 

There are no products listed under this category.