lmna

LMNA

 

Human Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Hu-96T DL Develop 96T
 
EUR 673
  • Should the Human Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-48T DL Develop 48T
 
EUR 527
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Mouse Lamin A/C (LMNA) ELISA Kit

DLR-LMNA-Mu-96T DL Develop 96T
 
EUR 688
  • Should the Mouse Lamin A/C (LMNA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Lamin A/C (LMNA) in samples from tissue homogenates or other biological fluids.

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-48Tests Reddot Biotech 48 Tests
 
EUR 544

Human Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Hu-96Tests Reddot Biotech 96 Tests
 
EUR 756

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-48Tests Reddot Biotech 48 Tests
 
EUR 557

Mouse Lamin A/C (LMNA) ELISA Kit

RDR-LMNA-Mu-96Tests Reddot Biotech 96 Tests
 
EUR 774

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-48Tests Reddot Biotech 48 Tests
 
EUR 521

Human Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Hu-96Tests Reddot Biotech 96 Tests
 
EUR 723

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-48Tests Reddot Biotech 48 Tests
 
EUR 533

Mouse Lamin A/C (LMNA) ELISA Kit

RD-LMNA-Mu-96Tests Reddot Biotech 96 Tests
 
EUR 740

LMNA Antibody

32042-100ul SAB 100ul
 
EUR 252

LMNA Antibody

1-CSB-PA003130 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

LMNA Antibody

1-CSB-PA003131 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

LMNA Antibody

1-CSB-PA144058 Cusabio
  •  
    EUR 317.00
  •  
    EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

LMNA Antibody

DF6052 Affbiotech 200ul
 
EUR 304
Description: LMNA Antibody detects endogenous levels of total LMNA.

LMNA Antibody

1-CSB-PA193640 Cusabio
  •  
    EUR 317.00
  •  
    EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

LMNA Antibody

1-CSB-PA013003GA01HU Cusabio
  •  
    EUR 597.00
  •  
    EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

LMNA Antibody

1-CSB-PA013003HA01HU Cusabio
  •  
    EUR 317.00
  •  
    EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LMNA. Recognizes LMNA from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200

LMNA siRNA

20-abx903004 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922680 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA siRNA

20-abx922681 Abbexa
  •  
    EUR 551.00
  •  
    EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LMNA Antibody

ABD6052 Lifescience Market 100 ug
 
EUR 438

pOTB7-LMNA

PVT18459 Lifescience Market 2 ug
 
EUR 231

LMNA Blocking Peptide

DF6052-BP Affbiotech 1mg
 
EUR 195

LMNA Conjugated Antibody

C32042 SAB 100ul
 
EUR 397

LMNA cloning plasmid

CSB-CL013003HU1-10ug Cusabio 10ug
 
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

LMNA cloning plasmid

CSB-CL013003HU2-10ug Cusabio 10ug
 
EUR 668
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1995
  • Sequence: atggagaccccgtcccagcggcgcgccacccgcagcggggcgcaggccagctccactccgctgtcgcccacccgcatcacccggctgcaggagaaggaggacctgcaggagctcaatgatcgcttggcggtctacatcgaccgtgtgcgctcgctggaaacggagaacgcagggc
  • Show more
Description: A cloning plasmid for the LMNA gene.

anti-LMNA (4E7)

LF-MA30610 Abfrontier 100 ul
 
EUR 527
Description: Mouse Monoclonal to LMNA

Recombinant human LMNA

P1083 FN Test 100ug Ask for price
  • Uniprot ID: P02545-2
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human LMNA

Anti-LMNA antibody

STJ110962 St John's Laboratory 100 µl
 
EUR 277
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Anti-LMNA antibody

STJ24412 St John's Laboratory 100 µl
 
EUR 277
Description: The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome.

Anti-LMNA antibody

STJ140138 St John's Laboratory 150 µg
 
EUR 408
Description: Goat polyclonal to LMNA (Lamin A/C) - nucleus marker. The Lamin family of proteins make up the matrix of proteins located next to the inner nuclear membrane. During mitosis, the lamina matrix is reversibly disassembled as the Lamin proteins are phosphorylated. These proteins are thought to be involved in chromatin structure, nuclear stability and gene expression.

Cleaved-LMNA (D230) Antibody

1-CSB-PA000047 Cusabio
  •  
    EUR 222.00
  •  
    EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-LMNA (D230). Recognizes Cleaved-LMNA (D230) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Polyclonal LMNA Antibody (Center)

APR04303G Leading Biology 0.1ml
 
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LMNA (Center). This antibody is tested and proven to work in the following applications:

Lamin A (LMNA) Antibody

abx015912-100ul Abbexa 100 ul
 
EUR 411
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx119039 Abbexa
  •  
    EUR 314.00
  •  
    EUR 98.00
  •  
    EUR 398.00
  •  
    EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx125051 Abbexa
  •  
    EUR 495.00
  •  
    EUR 704.00
  •  
    EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

20-abx126963 Abbexa
  •  
    EUR 411.00
  •  
    EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-400ul Abbexa 400 ul
 
EUR 523
  • Shipped within 5-10 working days.

Lamin A (LMNA) Antibody

abx030198-80l Abbexa 80 µl
 
EUR 286
  • Shipped within 5-10 working days.

LMNA ELISA KIT|Human

EF001125 Lifescience Market 96 Tests
 
EUR 689

Rat LMNA shRNA Plasmid

20-abx986027 Abbexa
  •  
    EUR 801.00
  •  
    EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
 

There are no products listed under this category.